Words similar to n-

Example sentences for: n-

How can you use “n-” in a sentence? Here are some example sentences to help you improve your vocabulary:

DmLozenge and DmRunxB ) or two ( DmRunxA ) introns separating exons N-terminal to the Runt domain, but all of these have different positions, and were thus likely to have been incorporated subsequent to the divergence of these genes.
Additionally, two AT-hook like modules, which probably had an accessory DNA-binding function, were also inserted into a conserved α-helix directly N-terminal of the DPBB domain in the β' subunit.
The Registration Form final rule amends Form N-1A which is used by mutual funds to register under the Investment Company Act of 1940 and to offer their shares under the Securities Act of 1933.
An 8x polyhistidine epitope tag was added to the N-terminus of EGFP with an oligonucleotide adapter (5'AAAACTGCAGCGGCCGCCACCATGCACCAC-CACCACACCACCACCACGTGAGCAAGGGCGAGGAGCTGTTCACCG3').
1998; Michelitsch and Weissman 2000), also known as the Q/N-rich domain.