Words similar to located

Example sentences for: located

How can you use “located” in a sentence? Here are some example sentences to help you improve your vocabulary:

In the spleen, KJ1-26 +or GFP +cells were primarily located within the periarterial lymphoid sheaths (PALS), with fewer positive cells in the marginal zones, and only scattered positive cells in the red pulp (Table 2).
It linked to sites like the White House and Greenpeace and included declarations such as "This is My College , its [ sic ] located in the most incredible state in the world."
The transgene was detected by PCR amplification of a 200 bp product using a forward primer located in the β-catenin cDNA sequence (βcat3pb: 5' TCGTTCTTTTCACTCTGGTGGAT 3') and a reverse primer in the PrP promoter (PrP-S: 5' GTGGATACCCCCTCCCCCAGCCTAGACC 3').
Two of Beijing’s top attractions, the Summer Palace and the Western Hills, are located northwest of the capital’s relentless urban sprawl.
Thus, the authors concluded that the primary dysfunction is located in the left hemisphere and that the hyperactivation of the right hemisphere might not be the cause of stuttering, but rather a compensatory process.