Words similar to kanmx
Example sentences for: kanmx
How can you use “kanmx” in a sentence? Here are some example sentences to help you improve your vocabulary:
Here we constructed pct1Δ and pce1Δ plasmids containing 5' and 3' flanking genomic sequences in which the entire triphosphatase or guanylyltransferase coding sequence was deleted and replaced by the kanamycin resistance gene [ 17 ] . The pct1::kanMX and pce1::kanMX constructs were transformed separately into a diploid strain of S. pombe and chromosomal integrants containing one copy of the wild-type gene and one of pct1::kanMX or pce1::kanMX were selected on medium containing G418.
We found for both knock-outs that 20 out of 20 tetrads yielded only 2 viable spores and all of the viable haploids were G418-sensitive, i.e., none contained the pct1::kanMX or pce1::kanMX alleles.
Expression of the capping enzymes from these plasmids is driven by the nmt1* promoter [ 19 ] . The plasmids were transformed into heterozygous pct1 +/ pct1::kanMX or pce1 +/ pct1::kanMX diploids using the lithium acetate method [ 18 ] . The Leu +diploid transformants were then sporulated on ME plates at room temperature.
The pct1::kanMX cassette was PCR-amplified from the pPCT1Δ plasmid using primers LI and L4.
prad26reverse : GATGTGGGTGCGGGACGGGAAAGAACAACACTGAAGAAACAAGTATCATTATTTCATTTGAAAAATTAGGGAAATGAATTCGAGCTCGTTTAAAC) were used to amplify the GFP (S65T)-kanMX6 module of pFA6a-GFP (S65T)-kanMX6 [ 41 ] in ten separate 50 μl PCR reactions using Accuzyme, high-fidelity polymerase (Bioline, Randolph, MA).