Words similar to kanmx

Example sentences for: kanmx

How can you use “kanmx” in a sentence? Here are some example sentences to help you improve your vocabulary:

We then sporulated the heterozygotes, dissected tetrads, and scored for spore viability and the presence of the kanMX marker.
We used a modified version of the long flanking homology PCR technique [ 17 ] to produce pct1Δ and pce1Δ gene disruption cassettes in which the open reading frames were replaced by the kanMX gene.
A 1570 bp DNA fragment containing an hnt2Δ::kanMX2 disruption cassette was generated as described [ 46 ] . Primers 4716 (5'GAAGCTCCATTGATCTATCTTGGGCTCAGAATGATCTTAAGCAAAACAAAGCTTCGTACGCTGCAG) and 4717 (5'CGTAAGTATGAATCTATTATTTATTGAACTATAGTGTTAAACCAGGGCCACTAGTGGATCTGA) were used to amplify the yeast expressible geneticin-resistance gene from pFA6a -kanMX2 [ 46 ] with 50 bp DNA ends corresponding to sequences upstream and downstream of HNT2 . The resulting fragment was transformed into haploid S. cerevisiae strain BY4727, and transformants were selected on YPD with 400 μg/ml geneticin.
pct1 +/ pct1::kanMX or pce1 +/ pce1::kanMX strains containing the control LEU2 plasmid vector lacking an insert were G418-resistant.
We found for both knock-outs that 20 out of 20 tetrads yielded only 2 viable spores and all of the viable haploids were G418-sensitive, i.e., none contained the pct1::kanMX or pce1::kanMX alleles.