Words similar to kanmx

Example sentences for: kanmx

How can you use “kanmx” in a sentence? Here are some example sentences to help you improve your vocabulary:

We then sporulated the heterozygotes, dissected tetrads, and scored for spore viability and the presence of the kanMX marker.
A transformant shown to contain the 1976 bp hnt2Δ::kanMX2 product in place of the wild-type 1200 bp HNT2 product was named strain BY16.
Genomic DNA was prepared from individual isolates and the integration of the pct1::kanMX or pce1::kanMX cassettes into the correct locus was tested by PCR using diagnostic primers.
A 1570 bp DNA fragment containing an hnt2Δ::kanMX2 disruption cassette was generated as described [ 46 ] . Primers 4716 (5'GAAGCTCCATTGATCTATCTTGGGCTCAGAATGATCTTAAGCAAAACAAAGCTTCGTACGCTGCAG) and 4717 (5'CGTAAGTATGAATCTATTATTTATTGAACTATAGTGTTAAACCAGGGCCACTAGTGGATCTGA) were used to amplify the yeast expressible geneticin-resistance gene from pFA6a -kanMX2 [ 46 ] with 50 bp DNA ends corresponding to sequences upstream and downstream of HNT2 . The resulting fragment was transformed into haploid S. cerevisiae strain BY4727, and transformants were selected on YPD with 400 μg/ml geneticin.
pct1 +/ pct1::kanMX or pce1 +/ pce1::kanMX strains containing the control LEU2 plasmid vector lacking an insert were G418-resistant.