Words similar to intergenic

Example sentences for: intergenic

How can you use “intergenic” in a sentence? Here are some example sentences to help you improve your vocabulary:

3 - 1.5 kb), we cannot demonstrate the co-existence of these intergenic variants by Northern blot analysis.
The 8R96 intergenic region probe was generated using primers 8R96-225683FWD (CAAGTGGGCTCCATAATAGC) and 8R96-226069REV (TGGAGCTCTCGGTCTGTTAG).
We also identified eight examples of novel genetic elements in non-melanogaster species, seven of which occur in intergenic regions (Figure 1).
Even in the well-finished and annotated human chromosomes, such as 20 and 22, some long intergenic region CSEs can still be found.
In these animals exon 3 and its splice acceptor were deleted, causing a rare intergenic transcript between Prion and Doppel to be highly upregulated and abnormally expressed in the brain, leading to late-onset ataxia and Purkinje cell degeneration [ 34 ] .