Words similar to ha-pp

Example sentences for: ha-pp

How can you use “ha-pp” in a sentence? Here are some example sentences to help you improve your vocabulary:

As such, we have chosen the 24 hr induction time for all subsequent experiments to ensure peak abundance of the induced 6His-HA-PP1α.
cDNA was resuspended in 20 ul water and used in a 30-cycle PCR reaction with 1 uM of each of the following four primers: {CCACGCTGTTTTGACCTCCATAGAAGACAC, CACATAGTCCCCCAGAAAGAGGTAGTTGCT}, in which product only forms from 6His-HA-PP1α cDNA, and {GACGCGGGCAAGCAGTCCCTCGAGACCATTGCCTGCTG, CTGGAGACCCACGACCTGGCCTGCCGTTG}, in which product only forms from endogenous PP1α cDNA.
The fusion gene was then cut from the 6His-HA-PP1α-pcDNA3 plasmid and ligated into pTEP4m, which contains a tetracycline response element for inducible expression [ 25 ] , and a hygromycin resistance gene for selection in eukaryotic cells (see Figure 1).
The doxycycline-independent increase in 6His-HA-PP1α is attributed to background expression when using this system [ 25 ] . As predicted for a protein under the control of the doxycycline-inducible promoter, the abundance of 6His-HA-PP1α decreases in the absence of the inducer over time (Figure 2C).
To address the possible autoregulatory mechanism(s) of PP1α expression and activity, we analyzed the RNA levels of both endogenous PP1α and induced 6His-HA-PP1α.