Words similar to gtcaccaagggtgtctgaag

Example sentences for: gtcaccaagggtgtctgaag

How can you use “gtcaccaagggtgtctgaag” in a sentence? Here are some example sentences to help you improve your vocabulary:

PCR primers (prdap25: cacctccaggatgtgttagc and prdazp26:gtcaccaagggtgtctgaag) were designed from intronic sequences flanking Dazap1 exon 8. These primers amplified a 271 bp fragment from mouse but not hamster genomic DNA.