Example sentences for: ggccagtgaattgtaatacgactcactatagggaggcg-gtttttttttttttttttttttttt

How can you use “ggccagtgaattgtaatacgactcactatagggaggcg-gtttttttttttttttttttttttt” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • Total RNA isolated from dissected larval tissues or poly(A) +RNA purified from embryos was incubated with 100 ng oligo(dT) 24 -T7 primer (GGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCG-GTTTTTTTTTTTTTTTTTTTTTTTT) and 125 ng TS primer (AAGCAGTGGTAACAACGCAGAGTACGCGGG) in 5 μl at 65°C for 10 min and cooled on ice.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast