Words similar to ggcatccagc
- ggcaaaggtgaacacaaggt-
- ggcaagctataacaaatcctgaga
- ggcaatcgctggtccagctggagtttgtctcaggc-
- ggcaatggaacgaacc
- ggcagcagccacctcacggt-
- ggcatccagc
- ggcatctttcttgattgc
- ggccagtgaattgtaatacgactcactatagggaggcg-gtttttttttttttttttttttttt
- ggccagtgaattgtaatacgactcactatagggaggcgg-
- ggccatggaacaaggatgaga
- ggccgacattaattgcttatatgc
Example sentences for: ggcatccagc
How can you use “ggcatccagc” in a sentence? Here are some example sentences to help you improve your vocabulary:
The 3'-end of the coding region of the midasin gene was fused to a tag encoding 3× hemagglutamin (HA) by using the PCR-mediated cassette procedure of Longtine and colleagues [ 60 ] . The PCR primers used to generate the cassette were 5'-ACTGATTTTG CGTCAATACT TTACAGACCT GGCATCCAGC CGGATCCCCG GGTTAATTAA-3' and 5'-TCGTGTAGTA AACCTCCTCT TCTTGGTTTT CACGATATAC GAATTCGAGC TCGTTTAAAC-3'.
Loading...