Words similar to ggccgcttaactttgattccattcttggatccagaagctccag
- ggcatctttcttgattgc
- ggccagtgaattgtaatacgactcactatagggaggcg-gtttttttttttttttttttttttt
- ggccagtgaattgtaatacgactcactatagggaggcgg-
- ggccatggaacaaggatgaga
- ggccgacattaattgcttatatgc
- ggccgcttaactttgattccattcttggatccagaagctccag
- ggcct-
- ggccttctccatggtggtgaagac-
- ggcggcacatctgttaaa
- ggcgggcctgctcct-
- ggcgtagtgtttggactggt-
Example sentences for: ggccgcttaactttgattccattcttggatccagaagctccag
How can you use “ggccgcttaactttgattccattcttggatccagaagctccag” in a sentence? Here are some example sentences to help you improve your vocabulary:
The CAS peptide was transferred to pLexA as follows: Two complementary oligos which encoded the 11 amino acid CAS peptide (oVT2899: AATTCTGGAGCTTCTGGATCCAAGAATGGAATCAAAGTTAAG, and oVT2900: GGCCGCTTAACTTTGATTCCATTCTTGGATCCAGAAGCTCCAG) were annealed in PCR buffer and cloned using standard methods into pVT725 via EcoRI and NotI restriction sites.
Loading...