Words similar to gagagagagagagagagagaactagtctcgagttttttittttttttttt-
Example sentences for: gagagagagagagagagagaactagtctcgagttttttittttttttttt-
How can you use “gagagagagagagagagagaactagtctcgagttttttittttttttttt-” in a sentence? Here are some example sentences to help you improve your vocabulary:
First-strand cDNA synthesis was primed from the 3' end of the poly(A) RNA using a poly(T) primer that also contained an Xho I restriction site and a GAGA sequence (5'-GAGAGAGAGAGAGAGAGAGAACTAGTCTCGAGTTTTTTITTTTTTTTTTT-3').
Loading...