Words similar to gagaaggtggag

Example sentences for: gagaaggtggag

How can you use “gagaaggtggag” in a sentence? Here are some example sentences to help you improve your vocabulary:

The clones were: Clone T/F 1-471 bp of 7.194 Kb cDNA [using primers T 5' GGTCTCAACTTAAACTCCAGCACCACGA 3' with the primer F] and clone G/A 246-2007 bp of 7.194 Kb cDNA [using primer G 5' GAGAAGGTGGAG AACCTCTCCATTCAGC 3' with primer A].