Words similar to gacgcgggcaagcagtccctcgagaccattgcctgctg

Example sentences for: gacgcgggcaagcagtccctcgagaccattgcctgctg

How can you use “gacgcgggcaagcagtccctcgagaccattgcctgctg” in a sentence? Here are some example sentences to help you improve your vocabulary:

cDNA was resuspended in 20 ul water and used in a 30-cycle PCR reaction with 1 uM of each of the following four primers: {CCACGCTGTTTTGACCTCCATAGAAGACAC, CACATAGTCCCCCAGAAAGAGGTAGTTGCT}, in which product only forms from 6His-HA-PP1α cDNA, and {GACGCGGGCAAGCAGTCCCTCGAGACCATTGCCTGCTG, CTGGAGACCCACGACCTGGCCTGCCGTTG}, in which product only forms from endogenous PP1α cDNA.