Words similar to gacctaacatgttctagccagaag
- gaccccgggcgtggtgggatttgggctgtatgg-
- gaccccgggctacgcggccgggaacaacaatg-
- gaccccgggctggggttacagtgggacgagt-
- gaccccggggaatgataccggctttagttgtga-
- gaccccgggggtgctgcccaacgtcaactacac-
- gacctaacatgttctagccagaag
- gacctctgtggcgacttcat-
- gaccttccatacacatcg-
- gacgcgggcaagcagtccctcgagaccattgcctgctg
- gacggtatcgataagctt
- gacggtatcgataagctt-
Example sentences for: gacctaacatgttctagccagaag
How can you use “gacctaacatgttctagccagaag” in a sentence? Here are some example sentences to help you improve your vocabulary:
A 169-base-pair DNA fragment of the factor V gene that includes nucleotide 1691 was amplified utilizing the polymerase chain reaction (PCR) with the forward primer 5'CATACTACAGTGACGTGGAC3' and the reverse primer 5'GACCTAACATGTTCTAGCCAGAAG3'.
Loading...