Words similar to gacacctgccgaggtgtgtg

Example sentences for: gacacctgccgaggtgtgtg

How can you use “gacacctgccgaggtgtgtg” in a sentence? Here are some example sentences to help you improve your vocabulary:

DNA carrying the wildtype syk coding region was generated by polymerase chain reaction (PCR) using high fidelity polymerase (Perkin Elmer, Branchburg, NJ) forward- 5'gacacctgccgaggtgtgtg 3'and reverse 5'gagggaggtggctgacaatc 3'primers, and random-primed cDNA template derived from the human Burkitt's lymphoma cell line, Daudi.