Words similar to fwdfwd

Example sentences for: fwdfwd

How can you use “fwdfwd” in a sentence? Here are some example sentences to help you improve your vocabulary:

The DNA probe for exon 5 of the fwd gene was generated by PCR amplification from Drosophila genomic DNA using primers FWDFWD (TGCTTCCTCCATTTGGCGAAC) and FWDREV (ATCATCTGTGGCTCAGAGTCG).