Words similar to fwd

Example sentences for: fwd

How can you use “fwd” in a sentence? Here are some example sentences to help you improve your vocabulary:

The probe for exon 4 of the CG8677 gene was generated using primers CG8677FWD (ATCCGTACCAGTGGCTAAAAGG) and CG8677REV (TTCTTCAACAGCACCACTCGTC).
Both fwd and Cct1 are involved in phospholipid metabolism, and phospholipid signaling pathways are implicated in life-span regulation in Drosophila and other organisms [ 53].
The CG14975 ORF probe was generated using primers CG14975FWD (TCAGCCGAGAGATTCTAGAGAG) and CG14975REV (CATCGACCATTGTTCTCTCTCC).
Drosophila, fwd gene function is required for the formation of ring canals and cytoplasmic bridges during cytokinesis in male meiosis.
filamin : -DOX = 59 ± 11; +DOX = 318 ± 64; fold induction approximately 5. fwd : -DOX = 240± 7; +DOX = 2,303± 28; fold induction approximately 10.