Words similar to fwd

Example sentences for: fwd

How can you use “fwd” in a sentence? Here are some example sentences to help you improve your vocabulary:

FBI email, Craig D. to John L., "Fwd: Re: FFI Request,"Aug.
fwd encodes a 1-phosphatidylinositol 4-kinase (PI 4-kinase) that regulates actin organization and ring canal formation during germline cytokinesis [ 40].
The probe for exon 4 of the CG1049 gene was generated using primers CG1049EX4FWD (TCTGTCCGATGAATTCATCGCC) and CG1049EX4REV (ATGATTCAGGTTCTCACGTCCG).
Both fwd and Cct1 are involved in phospholipid metabolism, and phospholipid signaling pathways are implicated in life-span regulation in Drosophila and other organisms [ 53].
24, 2001; FBI email, Harry S. to Chuck F.,"Re: Fwd: 199M-MP-60130 (Zacarias Moussaoui),"Aug.