Words similar to fwd

Example sentences for: fwd

How can you use “fwd” in a sentence? Here are some example sentences to help you improve your vocabulary:

The probe for exon 3 of the Hr39 gene was generated using primers Hr39FWD (ACATGTCCAGCATCAAAGCGG) and Hr39REV (TATCGGTTGTAGTGCGCAGAC).
filamin and fwd are involved in the function of ring canals, which are membrane-associated actin cytoskeletal structures that create intercellular bridges between germline cells during early mitotic divisions [ 38, 39, 40].
In 12 cases, exon 19 deletions were also studied by length analysis of fluorescently labeled PCR products on a capillary electrophoresis device, using the following primers: EGFR -Ex19-FWD1, 5′- GCACCATCTCACAATTGCCAGTTA-3′, and EGFR -Ex19-REV1, 5′-Fam- AAAAGGTGGGCCTGAGGTTCA-3′.
Line PdL(3)8S25 contained an insert at the 5' end of the 'B' transcript of the four wheel drive ( fwd ) gene (Figure 3e).
The probe for exon 4 of the CG8677 gene was generated using primers CG8677FWD (ATCCGTACCAGTGGCTAAAAGG) and CG8677REV (TTCTTCAACAGCACCACTCGTC).