Words similar to fwd

Example sentences for: fwd

How can you use “fwd” in a sentence? Here are some example sentences to help you improve your vocabulary:

FBI email, Jane to John L., "Fwd: Re: FFI Request,"Aug.
Drosophila, fwd gene function is required for the formation of ring canals and cytoplasmic bridges during cytokinesis in male meiosis.
The probe for exon 4 of the CG8677 gene was generated using primers CG8677FWD (ATCCGTACCAGTGGCTAAAAGG) and CG8677REV (TTCTTCAACAGCACCACTCGTC).
fwd encodes a phosphatidylinositol 4-kinase (PI 4-kinase) that converts phosphatidylinositol (PI) to phosphatidylinositol 4-phosphate (PIP) [ 40].
The CG14975 ORF probe was generated using primers CG14975FWD (TCAGCCGAGAGATTCTAGAGAG) and CG14975REV (CATCGACCATTGTTCTCTCTCC).