Words similar to fwd

Example sentences for: fwd

How can you use “fwd” in a sentence? Here are some example sentences to help you improve your vocabulary:

The DNA probe for exon 5 of the fwd gene was generated by PCR amplification from Drosophila genomic DNA using primers FWDFWD (TGCTTCCTCCATTTGGCGAAC) and FWDREV (ATCATCTGTGGCTCAGAGTCG).
fwd B was overexpressed approximately 10-fold and associated with an average 8% increase in life span.
FBI email, Jane to John L., "Fwd: Re: FFI Request,"Aug.
28, 2001; FBI email, John L. to Steve and others,"Fwd: Re: FFI Request,"Aug.
The probe for exon 4 of the CG8677 gene was generated using primers CG8677FWD (ATCCGTACCAGTGGCTAAAAGG) and CG8677REV (TTCTTCAACAGCACCACTCGTC).