Words similar to fwd

Example sentences for: fwd

How can you use “fwd” in a sentence? Here are some example sentences to help you improve your vocabulary:

Drosophila, fwd gene function is required for the formation of ring canals and cytoplasmic bridges during cytokinesis in male meiosis.
filamin : -DOX = 59 ± 11; +DOX = 318 ± 64; fold induction approximately 5. fwd : -DOX = 240± 7; +DOX = 2,303± 28; fold induction approximately 10.
28, 2001; FBI email, John L. to Steve and others,"Fwd: Re: FFI Request,"Aug.
The CG14975 ORF probe was generated using primers CG14975FWD (TCAGCCGAGAGATTCTAGAGAG) and CG14975REV (CATCGACCATTGTTCTCTCTCC).
The enzymes encoded by fwd and Cct1 are both in the biosynthetic pathway for PIP2 and therefore might affect the insulin-like pathway by altering the availability of this substrate.