Words similar to fwd

Example sentences for: fwd

How can you use “fwd” in a sentence? Here are some example sentences to help you improve your vocabulary:

The DNA probe for exon 5 of the fwd gene was generated by PCR amplification from Drosophila genomic DNA using primers FWDFWD (TGCTTCCTCCATTTGGCGAAC) and FWDREV (ATCATCTGTGGCTCAGAGTCG).
The Sau96I-digested fluorescently labeled PCR products were analyzed by capillary electrophoresis, and the following primers were used: EGFR -Ex21-FWD1, 5′- CCTCACAGCAGGGTCTTCTCTGT-3′, and EGFR -Ex21-REV1, 5′-Fam- TCAGGAAAATGCTGGCTGACCTA-3′.
The 3E36 intergenic region probe was generated using primers 3E36-140120FWD (TTTCCATTTCCCTTCCACTGCC) and 3E36-1406038REV (TTACAGCTGCTCACTCACTCAC).
fwd encodes a phosphatidylinositol 4-kinase (PI 4-kinase) that converts phosphatidylinositol (PI) to phosphatidylinositol 4-phosphate (PIP) [ 40].
The 8R96 intergenic region probe was generated using primers 8R96-225683FWD (CAAGTGGGCTCCATAATAGC) and 8R96-226069REV (TGGAGCTCTCGGTCTGTTAG).