Example sentences for: fwdrev

How can you use “fwdrev” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • The DNA probe for exon 5 of the fwd gene was generated by PCR amplification from Drosophila genomic DNA using primers FWDFWD (TGCTTCCTCCATTTGGCGAAC) and FWDREV (ATCATCTGTGGCTCAGAGTCG).


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast