Words similar to fluorescently
- fluorescein
- fluorescein-
- fluorescein-labeled
- fluorescence
- fluorescent
- fluorescent-dye
- fluorescent-labeled
- fluorescent-labelled
- fluorescent-protein
- fluorescent-tag-labeled
- fluorescently
- fluorescently-conjugated
- fluorescently-labeled
- fluorescently-labelled
- fluorescents
- fluoresces
- fluoridated
- fluoridation
- fluoride
- fluorolink
- fluorolog
Example sentences for: fluorescently
How can you use “fluorescently” in a sentence? Here are some example sentences to help you improve your vocabulary:
o for each fluorophore, where B is the cpm of [ 125I] SP specifically bound in the presence of non-radioactive SP and B o is the cpm of [ 125I] SP specifically bound in the presence of 100 pM fluorescently labeled SP.
Double stranded, fluorescently labelled (FAM, JOE, or NED) oligonucleotides (5' labelled oligonucleotide: CAGGAGATGCTGTTCGTAGG, unlabelled oligonucleotide: ACGAACAGCATCTCCT, supplier: Applied Biosystems) were annealed in 10 mM Tris pH 8.0, 10 mM NaCl, and 1 mM EDTA (3 min. at 94°C, cooling to 20°C within 15 minutes).
By labeling cells with fluorescently tagged antibodies that recognize one or more cell surface molecules, the relative and absolute numbers of specific cells can be determined by a technique called flow cytometry.
In 12 cases, exon 19 deletions were also studied by length analysis of fluorescently labeled PCR products on a capillary electrophoresis device, using the following primers: EGFR -Ex19-FWD1, 5′- GCACCATCTCACAATTGCCAGTTA-3′, and EGFR -Ex19-REV1, 5′-Fam- AAAAGGTGGGCCTGAGGTTCA-3′.
DNA probes, generated by reverse transcribing the amplified RNA, were fluorescently labeled (Cy5 for Alu I, Cy3 for Rsa I), pooled, and hybridized to microarrays containing the yeast open reading frames.
Loading...