Words similar to fluorescently
- fluorescein
- fluorescein-
- fluorescein-labeled
- fluorescence
- fluorescent
- fluorescent-dye
- fluorescent-labeled
- fluorescent-labelled
- fluorescent-protein
- fluorescent-tag-labeled
- fluorescently
- fluorescently-conjugated
- fluorescently-labeled
- fluorescently-labelled
- fluorescents
- fluoresces
- fluoridated
- fluoridation
- fluoride
- fluorolink
- fluorolog
Example sentences for: fluorescently
How can you use “fluorescently” in a sentence? Here are some example sentences to help you improve your vocabulary:
Detailed procedures for preparation of cDNA and fluorescently labeled cRNA, hybridization, staining, and scanning of gene chips and assay monitoring are outlined by Vahey et al . [ 16 ] . The platform chosen for global expression profile was the Rat Tox U34 Array (Affymetrix, Santa Clara, California), which contains probes for EST clusters and genes linked to a variety of toxic endpoints (total of 1031 probe sets including controls).
For each hybridization, 2 μg of each purified sample of polyadenylated RNA was reverse-transcribed in the presence of fluorescently labeled nucleoside triphosphates (Cy3-dUTP for reference sample, Cy5-dUTP for experimental sample).
Double stranded, fluorescently labelled (FAM, JOE, or NED) oligonucleotides (5' labelled oligonucleotide: CAGGAGATGCTGTTCGTAGG, unlabelled oligonucleotide: ACGAACAGCATCTCCT, supplier: Applied Biosystems) were annealed in 10 mM Tris pH 8.0, 10 mM NaCl, and 1 mM EDTA (3 min. at 94°C, cooling to 20°C within 15 minutes).
Fluorescently labeled cDNA was produced using a two-step procedure involving cDNA production from target RNA using a reverse transcriptase reaction incorporating aminoallyl-modified deoxynucleotide (aadUTP), followed by the second step involving chemical coupling of fluorescent dye (either Cy3 or Cy5) to the introduced amino moieties of the newly synthesized cDNA.
The basic methodology is to hybridize the fluorescently labeled genomic DNA of the strain of interest to the microarray along with the fluorescently labeled genomic DNA of a reference strain, typically the strain whose genome sequence the array was based on.