Example sentences for: fibulin-

How can you use “fibulin-” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • To test whether the fibulin-1C interaction with proHB-EGF maps to the heparin-binding region, a construct, pGBT9/prodelHB-EGF, containing amino acid residues Asp 106-His 159(the entire EGF like region of proHB-EGF and 18 out of 32 residues of the heparin-binding region) [ 2 ] was used in the yeast two-hybrid system (see materials and methods).

  • 2 % identity with the amino acid sequence for human fibulin-1C (GenBank accession number NP_001987).

  • the EGF-like modules of fibulin-1C interacting with the heparin-binding region of fibronectin) or with EGF-like modules (e.g.

  • Aggrecan and versican are aggregating proteoglycans that are key constituents found in the extracellular matrix [ 41 ] . Both proteoglycans contain amino-terminal hyaluronic acid-binding regions, central core glycosaminoglycan attachment domains, and carboxyl-terminal domains containing EGF-like modules (one in aggrecan and two in versican), C-type lectin like modules and complement regulatory protein-like modules [ 49 50 ] . Fibulin-1 exhibits calcium-dependent binding to the carboxyl-terminal domain of aggrecan and versican [ 41 ] . The binding site of aggrecan to fibulin-1 maps to the type II EGF-like modules 8-9 and the carboxyl-terminal domain of fibulin-1 [ 41 ] . The binding site of versican to fibulin-1 maps to the type II EGF-like modules 2-8 of fibulin-1 [ 41 ] .

  • 3) and the carboxyl terminus of monkey fibulin-1C were amplified by PCR using primers Fib5priCAPPAE 5'CGAATTCTGCGCGCCACCTGCTGA and Fib3priFVSAEL 5'CCGTCGACTCAGAGCTCTGCAGACACAAA.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast