Words similar to fibulin-
Example sentences for: fibulin-
How can you use “fibulin-” in a sentence? Here are some example sentences to help you improve your vocabulary:
3) of monkey fibulin-1C were amplified by PCR using primers Fib5priYLNDRC 5'CGAATTCTATCTGAATGACCGCTGC and Fib3priCAPPAE 5'CCGTCGACTCACTCAGCAGGTGGCGCGCA.
The extracellular domain of proHB-EGF interacts with monkey fibulin-1C (Additional file 1).
Fibulin-1 has been reported to interact with such extracellular matrix proteins as fibronectin, laminin, nidogen, aggrecan and versican [ 39 40 41 42 ] . Fibronectin is a glycoprotein found as multimers in insoluble form in the extracellular matrix.
Fibulin-1 is a calcium-binding extracellular matrix glycoprotein that is associated with various connective tissues, basement membranes and blood [ 37 38 39 ] . Splicing of the C terminal domain of fibulin-1 can lead to the expression of different variants of fibulin-1 (A-D) [ 37 ] . The amino acid sequence of the human fibulin-1C protein encodes five domains: a signal sequence (35 amino acid residues), three anaphylatoxin type I repeats (108 residues), an adjoining sequence (33 amino acid residues), nine calcium-binding type II EGF-like modules (387 amino acid residues), and a carboxyl domain (116 amino acid residues) [ 37 ] . The amino acid sequence derived from the nucleotide sequence obtained for monkey fibulin-1C (GenBank accession number AF395659) shows it to share 97.
The site of fibulin-1 binding to laminin maps to the carboxyl-terminal segment of the laminin A chain which consists of five basic tandem repeats containing conserved glycine and cysteine residues [ 39 46 ] . The binding site of laminin to fibulin-1 maps to the calcium-binding type II EGF-like modules of fibulin-1 [ 39 ] .
Loading...