Words similar to fibulin-
Example sentences for: fibulin-
How can you use “fibulin-” in a sentence? Here are some example sentences to help you improve your vocabulary:
Aggrecan and versican are aggregating proteoglycans that are key constituents found in the extracellular matrix [ 41 ] . Both proteoglycans contain amino-terminal hyaluronic acid-binding regions, central core glycosaminoglycan attachment domains, and carboxyl-terminal domains containing EGF-like modules (one in aggrecan and two in versican), C-type lectin like modules and complement regulatory protein-like modules [ 49 50 ] . Fibulin-1 exhibits calcium-dependent binding to the carboxyl-terminal domain of aggrecan and versican [ 41 ] . The binding site of aggrecan to fibulin-1 maps to the type II EGF-like modules 8-9 and the carboxyl-terminal domain of fibulin-1 [ 41 ] . The binding site of versican to fibulin-1 maps to the type II EGF-like modules 2-8 of fibulin-1 [ 41 ] .
3) of monkey fibulin-1C were amplified by PCR using primers Fib5priYLNDRC 5'CGAATTCTATCTGAATGACCGCTGC and Fib3priCAPPAE 5'CCGTCGACTCACTCAGCAGGTGGCGCGCA.
Fibulin-1 has been reported two exhibit calcium-dependent self-association [ 40 44 ] . The two self-association sites map to type II EGF-like modules 5 and 6 and to a cryptic site in the amino-terminal region of fibulin-1 [ 40 44 ] .
In the present report, we have identified two novel extracellular matrix proteins latent transforming growth factor β-binding protein 3 and fibulin-1C that interact with the extracellular domain of proHB-EGF.
the EGF-like modules of fibulin-1C interacting with the heparin-binding region of fibronectin) or with EGF-like modules (e.g.