Words similar to fibulin-
Example sentences for: fibulin-
How can you use “fibulin-” in a sentence? Here are some example sentences to help you improve your vocabulary:
To test whether the fibulin-1C interaction with proHB-EGF maps to the heparin-binding region, a construct, pGBT9/prodelHB-EGF, containing amino acid residues Asp 106-His 159(the entire EGF like region of proHB-EGF and 18 out of 32 residues of the heparin-binding region) [ 2 ] was used in the yeast two-hybrid system (see materials and methods).
2 % identity with the amino acid sequence for human fibulin-1C (GenBank accession number NP_001987).
the EGF-like modules of fibulin-1C interacting with the heparin-binding region of fibronectin) or with EGF-like modules (e.g.
Aggrecan and versican are aggregating proteoglycans that are key constituents found in the extracellular matrix [ 41 ] . Both proteoglycans contain amino-terminal hyaluronic acid-binding regions, central core glycosaminoglycan attachment domains, and carboxyl-terminal domains containing EGF-like modules (one in aggrecan and two in versican), C-type lectin like modules and complement regulatory protein-like modules [ 49 50 ] . Fibulin-1 exhibits calcium-dependent binding to the carboxyl-terminal domain of aggrecan and versican [ 41 ] . The binding site of aggrecan to fibulin-1 maps to the type II EGF-like modules 8-9 and the carboxyl-terminal domain of fibulin-1 [ 41 ] . The binding site of versican to fibulin-1 maps to the type II EGF-like modules 2-8 of fibulin-1 [ 41 ] .
3) and the carboxyl terminus of monkey fibulin-1C were amplified by PCR using primers Fib5priCAPPAE 5'CGAATTCTGCGCGCCACCTGCTGA and Fib3priFVSAEL 5'CCGTCGACTCAGAGCTCTGCAGACACAAA.
Loading...