Words similar to facilities
Example sentences for: facilities
How can you use “facilities” in a sentence? Here are some example sentences to help you improve your vocabulary:
The national tourist office is also helpful, but in Canada the provinces jealously protect their prerogatives against the federal government, and maintain their own tourist offices that can give you detailed information about resorts, accommodations, camping, and sports facilities.
In addition to expanded physical facilities since the completion of Science, Engineering and Technology Building Phase Two, several of the programs in the school have expanded in terms of student and faculty size; the research and development contracts with federal and state agencies and private industry exceeded one million dollars in value for the first time last year; interaction of faculty and students with the other schools on campus increased drastically in terms of joint research projects on medical imaging, computational neuroscience and biomechanics and the partnership with Naval Avionics Warfare Center and Naval Weapons Center flourished with the moving of Electronic Manufacturing Productivity Facility from California to a new facility within one mile of the main campus.
However, engaging physicians and medical directors to become directly involved in quality improvement projects at their facilities is often a challenge.
Potential true positive clones were sequenced using primers GAD10SEQ 5'TACCACTACAATGGATG and GAD10cSEQ 5'GTTGAAGTGAACTTGCGGGG with the automated DNA sequencing facilities available at our Institution.
In a sunny sheltered basin high in the Boite valley of the eastern Dolomites, it provides excellent skiing facilities as well as skating and bobsledding.
Loading...