Words similar to epithelial
Example sentences for: epithelial
How can you use “epithelial” in a sentence? Here are some example sentences to help you improve your vocabulary:
We previously demonstrated that the chemokines IL-8, MCP-1 and RANTES are differentially regulated in A549 airway epithelial cells [ 35 36 37 38 ] . To further elucidate the mechanisms of chemokine expression in A549, we have compared the induction of IL-8, MCP-1 and RANTES by RSV infection with that of TNFα.
Androgen deprivation produces profound involution of the prostate, particularly of the epithelial component, but little or no change in the external genitalia.
Previously, studies of phenotypes in this laboratory have shown that SPARC-null mice develop osteopenia around 2.5 months of age [ 19 ] in bones where SPARC is normally the most abundant non-collagenous glycoprotein [ 3 ] . The second phenotype thus far uncovered is in the lens where SPARC is normally produced by lens epithelial cells [ 20 21 ] and is a component of the lens capsule [ 20 22 ] . SPARC-null mice show progressive cataract formation beginning approximately 1.5 months after birth [ 14 21 ] . Electron microscopy of the SPARC-null lens revealed abnormality at the lens cell-ECM (capsule) interface with an intrusion of cellular processes into the basement membrane of the lens capsule, whereas wild-type lens exhibited a precise border at the cell-matrix interface [ 23 ] . In the present study, we show for the first time that SPARC plays a role in wound repair in vivo and in vitro.
Primers sets for the epithelial calcium channel were as follows: sense primer 5'TGAACCTGGTGCGCGCACTGC3' (GenBank accession number AJ271207.
The goals of this work were twofold: to use cDNA microarrays to characterize the primary response of intestinal epithelial cells to a well-studied intracellular pathogen, L. monocytogenes , and to try to identify host gene-expression programs which are induced by specific stages of the infection by comparing the wild-type expression profile to that of mutants which are either incapable of intracellular growth and thus avirulent, or which cannot initiate actin polymerization in host cell cytoplasm.
Loading...