Example sentences for: detected

How can you use “detected” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • The protein is frequently expressed throughout the cell cycle of proliferating cells, and it has not been detected in non-proliferating cells.

  • Blocking IFN-γ activity during in vitro priming with a neutralizing anti-IFN-γ antibody had little effect on the number of IFN-γ-secreting effector cells detected on subsequent restimulation.

  • The transgene was detected by PCR amplification of a 200 bp product using a forward primer located in the β-catenin cDNA sequence (βcat3pb: 5' TCGTTCTTTTCACTCTGGTGGAT 3') and a reverse primer in the PrP promoter (PrP-S: 5' GTGGATACCCCCTCCCCCAGCCTAGACC 3').

  • The 2.7-kbp fragment was also detected with an ARG4 -specific probe (not shown).

  • This influx of oxygenated blood alters the strength of the local magnetic field in proportion to the increase in flow, which is detected and recorded by the imaging machinery.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast