Example sentences for: dde

How can you use “dde” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • MCP-2 and Cystatin C cDNAs contain all six restriction sites within 500 bp from the poly-A tail (experimental fragment lengths including poly-A tail and labelling oligonucleotides: MCP-2/Cystatin C: Dde I: 196.

  • Percent recovery and precision among duplicates was equally good for DDE.

  • To generate a restriction-free region at the 5' side of the cDNA cloning site (EcoR I-Xho I) a 860 bp long PCR fragment of human genomic DNA (primers: CCCCAAGCTTGAGTATGAACAAATTTACTTTCTTCTTTC and CCGGCGCGCCTCCTAAAGTGCTGGATTATAG) devoid of Alu I, Dpn I, Dde I, Hinf I and Rsa I was inserted between the Hind III and Asc I site of the vectors.

  • When PCB and DDE measurements were analyzed as a continuous variable, they were transformed to the natural log scale because they were skewed towards higher concentrations.

  • fingerprint MCP-2, Bfa I, Hinf I, Rsa I, Dpn I, Dde I, Alu I) CTAGN 177-181 GANTCN 90-94 GTACN 3-7 GATCN 41-45 CTNAGN 123-127 AGCT were derived from the restriction fingerprints.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast