Words similar to dde
Example sentences for: dde
How can you use “dde” in a sentence? Here are some example sentences to help you improve your vocabulary:
Contamination of the Great Lakes has led to the bioaccumulation of polychlorinated biphenyls (PCBs) in fish, particularly the larger predator species prized by sport-fishers [ 1 2 3 ] . These compounds are synthetic organochlorines (OC) that, along with dichlorodiphenyl-dichloroethene (DDE), comprise the bulk of OC residues found in human tissues [ 4 ] , and some of the highest body burdens of PCBs in humans are found among fish consumers [ 5 6 7 8 ] . Consumption of these contaminated Great Lakes fish has been associated with several adverse reproductive outcomes including shortened menstrual cycle [ 9 ] , reduced fecundability [ 10 11 ] , reduced neonatal size [ 12 ] , and neurologic disorders [ 13 14 15 ] .
To generate a restriction-free region at the 5' side of the cDNA cloning site (EcoR I-Xho I) a 860 bp long PCR fragment of human genomic DNA (primers: CCCCAAGCTTGAGTATGAACAAATTTACTTTCTTCTTTC and CCGGCGCGCCTCCTAAAGTGCTGGATTATAG) devoid of Alu I, Dpn I, Dde I, Hinf I and Rsa I was inserted between the Hind III and Asc I site of the vectors.
PCB and DDE analysis
Under the Congressional Great Lakes Critical Programs Act of 1990, the health departments of Wisconsin, Illinois, Indiana, Ohio, and Michigan formed a consortium to assess PCB and DDE exposure risks and reproductive effects of contaminated Great Lakes Sport-Caught Fish (GLSCF) consumption.
In a second step, the plasmids were digested with restriction enzymes recognizing 4 bp sequences (Alu I, Bfa I, Dde I Dpn I, Hinf I, or Rsa I) in six separate reactions (Fig.
Loading...