Example sentences for: dde

How can you use “dde” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • After 2 hours at 37°C, the reactions were stopped by heating to 80°C for 20 minutes and the reactions Bfa I, Dpn I and Rsa I as well as Dde I, Alu I and Hinf I were pooled, respectively.

  • To generate a restriction-free region at the 5' side of the cDNA cloning site (EcoR I-Xho I) a 860 bp long PCR fragment of human genomic DNA (primers: CCCCAAGCTTGAGTATGAACAAATTTACTTTCTTCTTTC and CCGGCGCGCCTCCTAAAGTGCTGGATTATAG) devoid of Alu I, Dpn I, Dde I, Hinf I and Rsa I was inserted between the Hind III and Asc I site of the vectors.

  • A study of Great Lakes fish consumers in Michigan also found no relation between serum DDE concentrations and sex ratio, but did find that fathers with serum PCB concentrations greater than 8.1 ng/mL had a higher percentage of male children (OR for a male child: 2.29; 95% CI: 1.11-4.

  • Under the Congressional Great Lakes Critical Programs Act of 1990, the health departments of Wisconsin, Illinois, Indiana, Ohio, and Michigan formed a consortium to assess PCB and DDE exposure risks and reproductive effects of contaminated Great Lakes Sport-Caught Fish (GLSCF) consumption.

  • Because GLSCF consumption contributes greatly to OC exposure, if a parent had eaten GLSCF, but not before the pregnancy of a given child being analyzed, for that child we assigned the parent the median PCB and DDE concentrations of the infrequent consumers.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast