Words similar to dde
Example sentences for: dde
How can you use “dde” in a sentence? Here are some example sentences to help you improve your vocabulary:
Under the Congressional Great Lakes Critical Programs Act of 1990, the health departments of Wisconsin, Illinois, Indiana, Ohio, and Michigan formed a consortium to assess PCB and DDE exposure risks and reproductive effects of contaminated Great Lakes Sport-Caught Fish (GLSCF) consumption.
To generate a restriction-free region at the 5' side of the cDNA cloning site (EcoR I-Xho I) a 860 bp long PCR fragment of human genomic DNA (primers: CCCCAAGCTTGAGTATGAACAAATTTACTTTCTTCTTTC and CCGGCGCGCCTCCTAAAGTGCTGGATTATAG) devoid of Alu I, Dpn I, Dde I, Hinf I and Rsa I was inserted between the Hind III and Asc I site of the vectors.
The limit of detection for DDE in the Michigan Department of Public Health Laboratory was 0.50 ng/mL.
Because GLSCF consumption contributes greatly to OC exposure, if a parent had eaten GLSCF, but not before the pregnancy of a given child being analyzed, for that child we assigned the parent the median PCB and DDE concentrations of the infrequent consumers.
MCP-2 and Cystatin C cDNAs contain all six restriction sites within 500 bp from the poly-A tail (experimental fragment lengths including poly-A tail and labelling oligonucleotides: MCP-2/Cystatin C: Dde I: 196.
Loading...