Words similar to dde

Example sentences for: dde

How can you use “dde” in a sentence? Here are some example sentences to help you improve your vocabulary:

After 2 hours at 37°C, the reactions were stopped by heating to 80°C for 20 minutes and the reactions Bfa I, Dpn I and Rsa I as well as Dde I, Alu I and Hinf I were pooled, respectively.
The computer program checked if the peak for Dde I was contained in the complex peak mixture derived from the Dde I digest, considering a certain bandwidth.
PCB and DDE analysis
MCP-2 and Cystatin C cDNAs contain all six restriction sites within 500 bp from the poly-A tail (experimental fragment lengths including poly-A tail and labelling oligonucleotides: MCP-2/Cystatin C: Dde I: 196.
To generate a restriction-free region at the 5' side of the cDNA cloning site (EcoR I-Xho I) a 860 bp long PCR fragment of human genomic DNA (primers: CCCCAAGCTTGAGTATGAACAAATTTACTTTCTTCTTTC and CCGGCGCGCCTCCTAAAGTGCTGGATTATAG) devoid of Alu I, Dpn I, Dde I, Hinf I and Rsa I was inserted between the Hind III and Asc I site of the vectors.