Example sentences for: dde

How can you use “dde” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • To generate a restriction-free region at the 5' side of the cDNA cloning site (EcoR I-Xho I) a 860 bp long PCR fragment of human genomic DNA (primers: CCCCAAGCTTGAGTATGAACAAATTTACTTTCTTCTTTC and CCGGCGCGCCTCCTAAAGTGCTGGATTATAG) devoid of Alu I, Dpn I, Dde I, Hinf I and Rsa I was inserted between the Hind III and Asc I site of the vectors.

  • Five milliliters of serum was analyzed for DDE and several PCB congeners using the capillary column gas chromatography with the electron capture method [ 37 ] . Copies of the PCB and DDE laboratory methods and quality control protocols are available from the authors upon request.

  • MCP-2 and Cystatin C cDNAs contain all six restriction sites within 500 bp from the poly-A tail (experimental fragment lengths including poly-A tail and labelling oligonucleotides: MCP-2/Cystatin C: Dde I: 196.

  • It is possible that some chemical, or combination of chemicals, other than PCBs in the fish could lead to the changes in sex ratio we found, although this may be less likely given the specificity of our results for serum PCB and not DDE.

  • PCB and DDE analysis


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast