Words similar to daudi
Example sentences for: daudi
How can you use “daudi” in a sentence? Here are some example sentences to help you improve your vocabulary:
Stimulation through the BCR has been shown to induce changes in cell growth and viability in several B cell systems, including the human Daudi, chicken DT40 and mouse WEHI-231 and BCL 1 .3B3 B cell lymphomas [ 12 19 27 38 51 52 53 ] . For example, stimulation of BCL 1 .3B3 through the BCR suppressed exponential population growth in cell culture (Figure 1A).
DNA carrying the wildtype syk coding region was generated by polymerase chain reaction (PCR) using high fidelity polymerase (Perkin Elmer, Branchburg, NJ) forward- 5'gacacctgccgaggtgtgtg 3'and reverse 5'gagggaggtggctgacaatc 3'primers, and random-primed cDNA template derived from the human Burkitt's lymphoma cell line, Daudi.