Words similar to daudi
Example sentences for: daudi
How can you use “daudi” in a sentence? Here are some example sentences to help you improve your vocabulary:
DNA carrying the wildtype syk coding region was generated by polymerase chain reaction (PCR) using high fidelity polymerase (Perkin Elmer, Branchburg, NJ) forward- 5'gacacctgccgaggtgtgtg 3'and reverse 5'gagggaggtggctgacaatc 3'primers, and random-primed cDNA template derived from the human Burkitt's lymphoma cell line, Daudi.
Stimulation through the BCR has been shown to induce changes in cell growth and viability in several B cell systems, including the human Daudi, chicken DT40 and mouse WEHI-231 and BCL 1 .3B3 B cell lymphomas [ 12 19 27 38 51 52 53 ] . For example, stimulation of BCL 1 .3B3 through the BCR suppressed exponential population growth in cell culture (Figure 1A).
Loading...