Words similar to clone
Example sentences for: clone
How can you use “clone” in a sentence? Here are some example sentences to help you improve your vocabulary:
If we're talking betrayal, the real betrayal was that Lahti didn't leave the series once the troubled ER clone started to abandon its blue-scrub realism for the creepy random fancifulness that passes for creative on television these days.
Anti-calnexin (clone AF18), Anti-HSP90 (clone 3B6), and anti-HSP70 (5A5) are mouse monoclonal IgG antibodies, and were used at a 1:100 dilution.
Based on EST distribution, presenilin 2 (PS2) is less related to IL-8-tumor libraries (Z-score = 0.3, IL-8-tumor clone/Total Clone = 10%).
The clones were: Clone T/F 1-471 bp of 7.194 Kb cDNA [using primers T 5' GGTCTCAACTTAAACTCCAGCACCACGA 3' with the primer F] and clone G/A 246-2007 bp of 7.194 Kb cDNA [using primer G 5' GAGAAGGTGGAG AACCTCTCCATTCAGC 3' with primer A].
We verified the location of CARD15 on our map by amplifying a 444 bp fragment of exon 4 from clone 327F22 in our map (see additional data file 1, blau_map.pdf).