Example sentences for: cgaattctgcgcgccacctgctga

How can you use “cgaattctgcgcgccacctgctga” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • 3) and the carboxyl terminus of monkey fibulin-1C were amplified by PCR using primers Fib5priCAPPAE 5'CGAATTCTGCGCGCCACCTGCTGA and Fib3priFVSAEL 5'CCGTCGACTCAGAGCTCTGCAGACACAAA.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast