Example sentences for: cgaattctatctgaatgaccgctgc

How can you use “cgaattctatctgaatgaccgctgc” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • 3) of monkey fibulin-1C were amplified by PCR using primers Fib5priYLNDRC 5'CGAATTCTATCTGAATGACCGCTGC and Fib3priCAPPAE 5'CCGTCGACTCACTCAGCAGGTGGCGCGCA.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast