Example sentences for: cgaatagcctctccacccaa

How can you use “cgaatagcctctccacccaa” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • Neo B (5'-CGAATAGCCTCTCCACCCAA) was used as the Neo specific primer, and either PR1 (5'-GGAACAGTTCCGAAAGCTC) or PR2 (5'-GAGGAACACCACCTTAG) were used as the hnRNP A2/B1 specific primers.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast