Words similar to cacgaccgcctctctcgcactctc

Example sentences for: cacgaccgcctctctcgcactctc

How can you use “cacgaccgcctctctcgcactctc” in a sentence? Here are some example sentences to help you improve your vocabulary:

Nested PCR was then done to eliminate the possibility of artifacts using the GeneRacer 5' nested primer and p27 Kip1primers CACGACCGCCTCTCTCGCACTCTC for human and GGACCACCGCCTCGCCTCTC for mouse (see Figs.