Words similar to cacgatttgtgggtaaaataggag

Example sentences for: cacgatttgtgggtaaaataggag

How can you use “cacgatttgtgggtaaaataggag” in a sentence? Here are some example sentences to help you improve your vocabulary:

PCR was performed in 50 μL reactions containing: template, 50 pmol each of primers F3 (5'-CATAACGCCAGCCCACCTACTG-3') and ETn1 (5'-CACGATTTGTGGGTAAAATAGGAG C-3'), 2.5 units Taq DNA polymerase, 0.2 mM dNTPs, 20 mM TrisHCl (pH 8.4), 50 mM KCl, and 1.5 mM MgCl.