Example sentences for: atggaaacaccttgcttcttctccctc

How can you use “atggaaacaccttgcttcttctccctc” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • The genomic DNA fragment flanking the Fok I polymorphism was amplified using two primers flanking exon 2 of the VDR gene: AGCTGGCCCTGGCACTGCTCTGCTCT and ATGGAAACACCTTGCTTCTTCTCCCTC.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast