Example sentences for: atggcattagaaatagatatagataatg

How can you use “atggcattagaaatagatatagataatg” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • Based on the prediction, primers 5'ATGGCATTAGAAATAGATATAGATAATG 3'(primer A in Fig.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast