Words similar to atgagttaattcaaaccccacggacat

Example sentences for: atgagttaattcaaaccccacggacat

How can you use “atgagttaattcaaaccccacggacat” in a sentence? Here are some example sentences to help you improve your vocabulary:

DNA was transferred to a Southern blot and hybridized with a radiolabeled 172 bp fragment from the 3' P end of PdL . This probe fragment was generated by PCR amplification with primers located within the 3' P end, IRREV (ATGATGAAATAACATAAGGTGGTCCCG) and P3MCSREV (ATGAGTTAATTCAAACCCCACGGACAT).