Words similar to asp

Example sentences for: asp

How can you use “asp” in a sentence? Here are some example sentences to help you improve your vocabulary:

For those readers seeking an update on this challenging area, we would direct your attention to the Alzheimer Research Forum Web page (http://www.alzforum.org/new/detailprint.asp?id=1135), where you will find an excellent review of the literature as well as a series of evaluations of how our data fit into existing scenarios and models regarding cholesterol, statins, cerebral amyloidosis, and the cognitive failure of Alzheimer disease.
The EGF-like region (amino acid residues Asp 106-His 159) of monkey proHB-EGF [ 2 ] was amplified by PCR using primers MkHB-EGF 5'CTAGGGAAGGAATTCGACCCATGTCTTCGG and MkHB-EGF 3'CACAGCCAGGATGGATCCTCAATGGTCATAGG.
The American Chemistry Council has objections to REACH, stating that “the proposed regulation is burdensome, costly, and impractical” (http://www.accnewsmedia.com/site/page.asp?TRACKID=&VID=1&CID=359&DID=1256).
Asp, grasp, wasp, and cork and work.
Variations at residues alpha4 Thr183 and beta2 Ala135 generate different shapes of the binding pocket (Figure 4- Top), but preserve the electrostatic potential of the system: all non-conserved residues at position 183 are hydrophobic, and hydroxyl of Thr154 and Ser154 are superimposed, pointing away from the ligand, towards the carboxylate of Asp122.