Words similar to annealing
Example sentences for: annealing
How can you use “annealing” in a sentence? Here are some example sentences to help you improve your vocabulary:
[ 2 ] . The 3 parameters are determined by the use of global (simulated annealing) and local (Powell) non-linear optimization.
Reverse transcription-polymerase chain reaction (RT-PCR) was carried out as preciously described using an annealing temperature of 54°C [ 27 ] . The primers were prdap35: agctcagggagtacttcaaga and prdap24 :ggagcttgattcttgctgtcc for Dazap1 which generated a product of 211 bp, and prdaz71: atcgaactggtgtgtcgaagg and prdaz72: ggaggctgcatgtaagtctca for Dazl1 which generated a product of 245 bp.
PCR conditions other than annealing temperature used were the same as described above.
Each sample was amplified for 30 cycles of denaturation at 94°C for 1.5 minutes, annealing at 60°C for 1.75 minutes, and extension at 72°C for 2.5 minutes.
DNA sequences were determined by reamplifying the original genomic DNA using the appropriate family-specific V H leader and J H consensus primers under the following PCR conditions: denaturation at 94°C for 45s; annealing at 62°C for 30s; and extension at 72°C for 45s.
Loading...