Words similar to annealing
Example sentences for: annealing
How can you use “annealing” in a sentence? Here are some example sentences to help you improve your vocabulary:
The PKQuest global (simulated annealing) and local (Powell) optimization routines were used to select the fat blood flow that provided the best fit to the enflurane data.
2 (reverse, 5'-CAGATGAGACTGGGAAAGGC-3') at an annealing temperature of 55°C for 35 cycles.
Experimental studies have shown that the strand transfer reaction mediated by RecT and its binding to dsDNA are sensitive to Mg +2concentrations and it was proposed that the levels of free Mg +2could regulate RecT activity [ 4 ] . Similarly, Redβ has been shown to promote single strand annealing in a Mg +2-dependent manner [ 20 ] . In this context, the conservation of the two C-terminal acidic residues in the majority of members of this superfamily suggests that these might be involved in the coordination of Mg +2and implies that the metal ion-dependent conformational switching is likely to be a generic feature of this family.
In case of the DAMD PCR, annealing temperature of 50°C was found to be optimum for generating distinct profiles with all three primers.
Reverse transcription-polymerase chain reaction (RT-PCR) was carried out as preciously described using an annealing temperature of 54°C [ 27 ] . The primers were prdap35: agctcagggagtacttcaaga and prdap24 :ggagcttgattcttgctgtcc for Dazap1 which generated a product of 211 bp, and prdaz71: atcgaactggtgtgtcgaagg and prdaz72: ggaggctgcatgtaagtctca for Dazl1 which generated a product of 245 bp.