Example sentences for: annealed

How can you use “annealed” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • These primers annealed to both the normal and mutant OCPs.

  • The primers were annealed to template at 25°C for 10 min, and the reaction were incubated at 53°C for 1 h in the presence of Superscript Reverse transcriptase, 5 mM dNTP mix and RN'ase Out inhibitor.

  • The RNAseH substrate itself (DRF+ RNA annealed to D2507-) also supported DNA synthesis in the trans assay (lane 4), as did the combination of DRF+ RNA and the non-complementary oligonucleotide D2526+ (lane 5).

  • 40 nM CFTR M1101K12 OCP (Table I) was annealed to 100 nM oligo target, at 95°C, 2 min, and slow cooled to room temperature.

  • The CAS peptide was transferred to pLexA as follows: Two complementary oligos which encoded the 11 amino acid CAS peptide (oVT2899: AATTCTGGAGCTTCTGGATCCAAGAATGGAATCAAAGTTAAG, and oVT2900: GGCCGCTTAACTTTGATTCCATTCTTGGATCCAGAAGCTCCAG) were annealed in PCR buffer and cloned using standard methods into pVT725 via EcoRI and NotI restriction sites.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast