Words similar to annealed

Example sentences for: annealed

How can you use “annealed” in a sentence? Here are some example sentences to help you improve your vocabulary:

The negative control luciferase RNA was the same as the double-stranded GL3 RNA described previously [ 17 ] . The RNAs were annealed in vitro to form double-stranded RNA (dsRNA) [ 18 ] and electroporation was carried out essentially as described [ 32 ] . In brief, 3 μg dsRNA in 800 μl of incomplete cytomix [ 32 ] was added to infected RBC (at 10-15% parasitemia), and electroporation was performed using a Bio-Rad Gene Pulsar unit at settings of 200 Ω, 2 kV, and 25 μF.
We used a 5'- 32P labeled 30-mer synthetic U5-PBS RNA template annealed with a complementary 30-mer DNA to determine the RNase H activity of the enzymes [ 31 ] . The reaction mixture contained labeled RNA-DNA hybrid (10 K Cerenkov cpm), 50 mM Tris-HCl pH 8.0, 60 mM KCl, 10 mM dithiothreitol, 0.1 mg/ml bovine serum albumin, 5 mM MgCl
The CAS peptide was transferred to pLexA as follows: Two complementary oligos which encoded the 11 amino acid CAS peptide (oVT2899: AATTCTGGAGCTTCTGGATCCAAGAATGGAATCAAAGTTAAG, and oVT2900: GGCCGCTTAACTTTGATTCCATTCTTGGATCCAGAAGCTCCAG) were annealed in PCR buffer and cloned using standard methods into pVT725 via EcoRI and NotI restriction sites.
To examine DHBV RNAseH activity on exogenous substrates, internally 32P-labeled RNAs were synthesized in vitro and annealed to complementary DNA oligonucleotides.
The FADI primer was annealed at 48°C and the PLYT primer was annealed at 20°C.