Words similar to annealed
Example sentences for: annealed
How can you use “annealed” in a sentence? Here are some example sentences to help you improve your vocabulary:
These primers annealed to both the normal and mutant OCPs.
The primers were annealed to template at 25°C for 10 min, and the reaction were incubated at 53°C for 1 h in the presence of Superscript Reverse transcriptase, 5 mM dNTP mix and RN'ase Out inhibitor.
The RNAseH substrate itself (DRF+ RNA annealed to D2507-) also supported DNA synthesis in the trans assay (lane 4), as did the combination of DRF+ RNA and the non-complementary oligonucleotide D2526+ (lane 5).
40 nM CFTR M1101K12 OCP (Table I) was annealed to 100 nM oligo target, at 95°C, 2 min, and slow cooled to room temperature.
The CAS peptide was transferred to pLexA as follows: Two complementary oligos which encoded the 11 amino acid CAS peptide (oVT2899: AATTCTGGAGCTTCTGGATCCAAGAATGGAATCAAAGTTAAG, and oVT2900: GGCCGCTTAACTTTGATTCCATTCTTGGATCCAGAAGCTCCAG) were annealed in PCR buffer and cloned using standard methods into pVT725 via EcoRI and NotI restriction sites.