Words similar to annealed

Example sentences for: annealed

How can you use “annealed” in a sentence? Here are some example sentences to help you improve your vocabulary:

Both primer pairs annealed across intron insertion sites.
The FADI primer was annealed at 48°C and the PLYT primer was annealed at 20°C.
40 nM CFTR M1101K12 OCP (Table I) was annealed to 100 nM oligo target, at 95°C, 2 min, and slow cooled to room temperature.
To determine if the lack of success was specific to the DRF+ RNA, a second RNA, DXB+ (DHBV nt 1358-1504 positive polarity), annealed to the complementary oligonucleotide D1452- was employed in RNAseH assays.
Double stranded, fluorescently labelled (FAM, JOE, or NED) oligonucleotides (5' labelled oligonucleotide: CAGGAGATGCTGTTCGTAGG, unlabelled oligonucleotide: ACGAACAGCATCTCCT, supplier: Applied Biosystems) were annealed in 10 mM Tris pH 8.0, 10 mM NaCl, and 1 mM EDTA (3 min. at 94°C, cooling to 20°C within 15 minutes).