Example sentences for: amino

How can you use “amino” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • Tumor samples from patient 1 showed a T→G change at nucleotide 2573, resulting in the exon 21 L858R amino acid substitution commonly observed in drug-responsive tumors.

  • Here, we observed that prolongation in G1 required the amino terminal 97 amino acids of C/EBPα (Fig.

  • The CAS peptide was transferred to pLexA as follows: Two complementary oligos which encoded the 11 amino acid CAS peptide (oVT2899: AATTCTGGAGCTTCTGGATCCAAGAATGGAATCAAAGTTAAG, and oVT2900: GGCCGCTTAACTTTGATTCCATTCTTGGATCCAGAAGCTCCAG) were annealed in PCR buffer and cloned using standard methods into pVT725 via EcoRI and NotI restriction sites.

  • Therefore, the effect of 4EBP-1-5A on the de novo synthesis of p27 Kip1was tested by metabolic labeling with [ 35S]-labeled amino acids.

  • The amino acid change within this gene replaces a cysteine (B6) at residue 95 with an arginine (D2).


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast