Example sentences for: alu

How can you use “alu” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • Approximately 1.1 million Alu repeats were identified, as expected [ 50].

  • To determine the distance permitted between the TATA box and the transcription initiation site in pARS-VN, we cloned different sized Alu targeting hooks (45/45 bp, 45/65 bp, 45/75 bp, 65/65 bp, 75/75 bp, and 115/75 bp) into vector Xho I- Cla I sites.

  • 3% of the time and into SINE/ Alu just 3% of the time, most probably because Alu sequences have a relatively high GC content (56%).

  • To generate a restriction-free region at the 5' side of the cDNA cloning site (EcoR I-Xho I) a 860 bp long PCR fragment of human genomic DNA (primers: CCCCAAGCTTGAGTATGAACAAATTTACTTTCTTCTTTC and CCGGCGCGCCTCCTAAAGTGCTGGATTATAG) devoid of Alu I, Dpn I, Dde I, Hinf I and Rsa I was inserted between the Hind III and Asc I site of the vectors.

  • 5 U Bfa I, 1.0 U Dde I, 1.5 U Dpn I, 2.0 U Alu I, 1.0 U Rsa I, or 2.0 U Hinf I) were diluted in 10 μl buffer (20 mM Tris-acetate (pH 7.9), 10 mM magnesium acetate, 50 mM potassium acetate, 1 mM DTT, 100 μg/ml BSA) and added separately to the six rections (FAM: Bfa I and Dde I, JOE: Dpn I and Alu I, NED: Rsa I and Hinf I).


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast