Words similar to affinity

Example sentences for: affinity

How can you use “affinity” in a sentence? Here are some example sentences to help you improve your vocabulary:

eIF4E gene transcription is enhanced in response to mitogenic stimulation and may be mediated by c-myc [ 3 ] . Phosphorylation of eIF4E by the protein kinase Mnk1 increases its affinity for the cap, and thus increases cap-dependent initiation of translation [ 4 5 6 ] . An inhibitor of eIF4E, 4E binding protein (4EBP), is also regulated by phosphorylation.
However, surrogates may only need to contain some amino acids identical to those on the partner to bind with sufficient "avidity" rather than affinity.
All four proteins were expressed in insect cells from recombinant baculoviruses, purified by anti-HA affinity chromatography, and eluted with HA-epitope peptide.
Electrophoretic mobility shifts assays were done by mixing a radiolabeled oligonucleotide containing a consensus, high affinity C/EBP binding site (GATCGAGCCCCATTGCGCAATCATAGATC) together with extracts prepared from transfected cells as previously described [ 58 59 ] . Competition with the same, unlabeled oligonucleotide in 1, 10 or 100 molar excess of the radiolabeled probed indicated specific binding.
p60/Hop, p23, hsp40, FKBP52, and FKBP51) have been implicated in the assembly/stabilization of the GR-hsp90-hsp70-complex in a form that has high affinity for agonist [for review, see Ref.