Example sentences for: affinity

How can you use “affinity” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • eIF4E gene transcription is enhanced in response to mitogenic stimulation and may be mediated by c-myc [ 3 ] . Phosphorylation of eIF4E by the protein kinase Mnk1 increases its affinity for the cap, and thus increases cap-dependent initiation of translation [ 4 5 6 ] . An inhibitor of eIF4E, 4E binding protein (4EBP), is also regulated by phosphorylation.

  • However, surrogates may only need to contain some amino acids identical to those on the partner to bind with sufficient "avidity" rather than affinity.

  • All four proteins were expressed in insect cells from recombinant baculoviruses, purified by anti-HA affinity chromatography, and eluted with HA-epitope peptide.

  • Electrophoretic mobility shifts assays were done by mixing a radiolabeled oligonucleotide containing a consensus, high affinity C/EBP binding site (GATCGAGCCCCATTGCGCAATCATAGATC) together with extracts prepared from transfected cells as previously described [ 58 59 ] . Competition with the same, unlabeled oligonucleotide in 1, 10 or 100 molar excess of the radiolabeled probed indicated specific binding.

  • p60/Hop, p23, hsp40, FKBP52, and FKBP51) have been implicated in the assembly/stabilization of the GR-hsp90-hsp70-complex in a form that has high affinity for agonist [for review, see Ref.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast