Example sentences for: adapter

How can you use “adapter” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • An 8x polyhistidine epitope tag was added to the N-terminus of EGFP with an oligonucleotide adapter (5'AAAACTGCAGCGGCCGCCACCATGCACCAC-CACCACACCACCACCACGTGAGCAAGGGCGAGGAGCTGTTCACCG3').

  • Based on the phenotype of knockout mice, it has become clear that TRAF6 is the critical adapter molecule required for RANK signaling during osteoclastogenesis [ 35 ] . The importance of TRAF6 has been further explored in deletion studies, which correlated its various domains with its osteoclastogenic potential [ 46 ] . A link between IFN-γ and RANK signaling via TRAF6 has also been demonstrated in bone marrow cultures, in which IFN-γ was shown to accelerate the degradation of TRAF6 [ 38 ] . In our studies, however, we failed to observe this TRAF6 degradation, as its expression remained constant in both short-term and long-term cultures under conditions where IFN-γ completely inhibited osteoclastogenesis.

  • An anchored primer adapter was designed that contains a 5' T7 promoter and a 3' polyA (18 bps in length) stretch terminating in a single C, G, or T base.

  • TT adapter: AAC TCA GAG GTG AGA CAG GAG TGG AGG CA CC TCC GTG C

  • While analyzing the size distribution of the IVT product we noted a low molecular weight species that roughly corresponds in size to the primer adapter.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast