Words similar to vhasfd
Example sentences for: vhasfd
How can you use “vhasfd” in a sentence? Here are some example sentences to help you improve your vocabulary:
The sizes of the products were: PdL(3)3E36 ( Red herring/encore ) 534 bp; PdL(2)4G14 ( VhaSFD ) 465 bp; PdL(3)2C33 ( Sugar baby ) 464 bp; PdL(3)8S64 ( filamin ) 362 bp; PdL(3)8S25 ( fwd ) 345 bp; PdL(3)8R128 ( Cct1 ) 298 bp.
The probe for exon 2 of the VhaSFD gene was generated using primers VhaFWD (CCAGCTGATCCTTCAGGAACTGC) and VhaREV (ACCAGGACGATCAACTGGGCTTC).
The VhaSFD subunit is required for the ATPase activity and assembly of the vacuolar H +-ATPase and may function as a dissociable regulatory subunit.
VhaSFD : -DOX = 4.8 ± 1.2; +DOX = 20 ± 5.5; fold induction approximately 4. Sugar baby : -DOX = 1.5 ± 0.5; +DOX = 12.
Therefore, overexpression of VhaSFD may affect life span by increasing activity of the vacuolar H +-ATPase.
Loading...