Words similar to vhasfd

Example sentences for: vhasfd

How can you use “vhasfd” in a sentence? Here are some example sentences to help you improve your vocabulary:

When this difference is included in the calculations, the life span increases for VhaSFD and Sugar baby are approximately 20% and 17%, respectively.
The probe for exon 2 of the VhaSFD gene was generated using primers VhaFWD (CCAGCTGATCCTTCAGGAACTGC) and VhaREV (ACCAGGACGATCAACTGGGCTTC).
The VhaSFD gene encodes the Drosophila homolog of the vacuolar H +-ATPase SFD subunit.
Such a line might be expected to have an unusually high -DOX life span relative to the other lines, and it is notable that this appears to be the case for the lines bearing mutations in the VhaSFD and Sugar baby genes.
VhaSFD : -DOX = 4.8 ± 1.2; +DOX = 20 ± 5.5; fold induction approximately 4. Sugar baby : -DOX = 1.5 ± 0.5; +DOX = 12.