Words similar to vhasfd

Example sentences for: vhasfd

How can you use “vhasfd” in a sentence? Here are some example sentences to help you improve your vocabulary:

It is composed of a cytoplasmic ATPase domain called V 1 that contains VhaSFD and other subunits, and a multisubunit membrane-channel component called V 0 . The vacuolar ATPase is involved in the acidification and energization of organelles such as Golgi-derived vesicles, clathrin-coated vesicles, synaptic vesicles and lysosomes.
The probe for exon 2 of the VhaSFD gene was generated using primers VhaFWD (CCAGCTGATCCTTCAGGAACTGC) and VhaREV (ACCAGGACGATCAACTGGGCTTC).
Such a line might be expected to have an unusually high -DOX life span relative to the other lines, and it is notable that this appears to be the case for the lines bearing mutations in the VhaSFD and Sugar baby genes.
When this difference is included in the calculations, the life span increases for VhaSFD and Sugar baby are approximately 20% and 17%, respectively.
The VhaSFD subunit is required for the ATPase activity and assembly of the vacuolar H +-ATPase and may function as a dissociable regulatory subunit.