Words similar to vhasfd

Example sentences for: vhasfd

How can you use “vhasfd” in a sentence? Here are some example sentences to help you improve your vocabulary:

It is composed of a cytoplasmic ATPase domain called V 1 that contains VhaSFD and other subunits, and a multisubunit membrane-channel component called V 0 . The vacuolar ATPase is involved in the acidification and energization of organelles such as Golgi-derived vesicles, clathrin-coated vesicles, synaptic vesicles and lysosomes.
The probe for exon 2 of the VhaSFD gene was generated using primers VhaFWD (CCAGCTGATCCTTCAGGAACTGC) and VhaREV (ACCAGGACGATCAACTGGGCTTC).
DOX caused an approximately fourfold overexpression of the VhaSFD transcript and an average 8% increase in life span (Figure 3b).
Such a line might be expected to have an unusually high -DOX life span relative to the other lines, and it is notable that this appears to be the case for the lines bearing mutations in the VhaSFD and Sugar baby genes.
Therefore, overexpression of VhaSFD may affect life span by increasing activity of the vacuolar H +-ATPase.