Example sentences for: vhasfd

How can you use “vhasfd” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • The probe for exon 2 of the VhaSFD gene was generated using primers VhaFWD (CCAGCTGATCCTTCAGGAACTGC) and VhaREV (ACCAGGACGATCAACTGGGCTTC).

  • DOX caused an approximately fourfold overexpression of the VhaSFD transcript and an average 8% increase in life span (Figure 3b).

  • It is composed of a cytoplasmic ATPase domain called V 1 that contains VhaSFD and other subunits, and a multisubunit membrane-channel component called V 0 . The vacuolar ATPase is involved in the acidification and energization of organelles such as Golgi-derived vesicles, clathrin-coated vesicles, synaptic vesicles and lysosomes.

  • Therefore, overexpression of VhaSFD may affect life span by increasing activity of the vacuolar H +-ATPase.

  • The sizes of the products were: PdL(3)3E36 ( Red herring/encore ) 534 bp; PdL(2)4G14 ( VhaSFD ) 465 bp; PdL(3)2C33 ( Sugar baby ) 464 bp; PdL(3)8S64 ( filamin ) 362 bp; PdL(3)8S25 ( fwd ) 345 bp; PdL(3)8R128 ( Cct1 ) 298 bp.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast