Words similar to unlabelled
Example sentences for: unlabelled
How can you use “unlabelled” in a sentence? Here are some example sentences to help you improve your vocabulary:
Double stranded, fluorescently labelled (FAM, JOE, or NED) oligonucleotides (5' labelled oligonucleotide: CAGGAGATGCTGTTCGTAGG, unlabelled oligonucleotide: ACGAACAGCATCTCCT, supplier: Applied Biosystems) were annealed in 10 mM Tris pH 8.0, 10 mM NaCl, and 1 mM EDTA (3 min. at 94°C, cooling to 20°C within 15 minutes).
5b, lane 3) competed less well than did unlabelled probe.
As expected, lymphoblasts derived from the TRMA patient showed no high affinity thiamine transport as revealed by thiamine uptake being the same in the absence and presence of excess unlabelled thiamine.
With the DQA1*0501 probe, unlabelled DQA1*0101 sequence (Fig.
No difference in uptake of thiamine by TRMA mitochondria was found in the presence and absence of excess unlabelled thiamine (fig.
Loading...