Words similar to unlabelled

Example sentences for: unlabelled

How can you use “unlabelled” in a sentence? Here are some example sentences to help you improve your vocabulary:

The final concentration of the AR1 primer was 3 pmol 6-Fam-AR1+7 pmol unlabelled AR1 and 10 pmol of unlabeled AR2 in a 50 μl reaction.
No difference in uptake of thiamine by TRMA mitochondria was found in the presence and absence of excess unlabelled thiamine (fig.
As expected, lymphoblasts derived from the TRMA patient showed no high affinity thiamine transport as revealed by thiamine uptake being the same in the absence and presence of excess unlabelled thiamine.
Double stranded, fluorescently labelled (FAM, JOE, or NED) oligonucleotides (5' labelled oligonucleotide: CAGGAGATGCTGTTCGTAGG, unlabelled oligonucleotide: ACGAACAGCATCTCCT, supplier: Applied Biosystems) were annealed in 10 mM Tris pH 8.0, 10 mM NaCl, and 1 mM EDTA (3 min. at 94°C, cooling to 20°C within 15 minutes).
Background binding was determined by using a 100 fold excess of unlabelled thiamine or ThDP in parallel reactions.