Example sentences for: ttatttccgacaaaaagaaatatatgg

How can you use “ttatttccgacaaaaagaaatatatgg” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • 1, the start codon in bold) and 5'TTATTTCCGACAAAAAGAAATATATGG 3'were first tested, but no product was obtained.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast