Words similar to translation

Example sentences for: translation

How can you use “translation” in a sentence? Here are some example sentences to help you improve your vocabulary:

When the gospel writers read Isaiah 7:14 in the Greek, they read parthenos , the Greek translation of ` almah . This term had a narrower range of meaning than ` almah , and more specifically meant “virgin,” but it was within the range of equivalence for the Hebrew term ` almah . The gospel writer did not misquote the Bible in this matter.
In English translation they are as follows:
2 kb upstream of the translation start codon of pct1 +or pce1 +; L2, a 40-mer in which 20 bases were identical to the 5' sequence of pFA6a-KanMX4 (GCTTCAGCTGGCGGCCGCGT) and 20 bases were identical to the antisense strand sequence immediately 5' of the translation start site of pct1 +or pce1 +; L3, a 40-mer in which 20 bases were identical to the 3' sequence of pFA6a-KanMX4 (AGTGGCCTATGCGGCCGCGG) and 20 bases corresponded to the sense-strand sequence immediately 3' of the stop codon of
This reduction was shown to be due to a decreased initiation rate for translation.
But that is as near as you can come to a one-word translation of the meaning.