Example sentences for: taaatgttttgatacaaattatgagc

How can you use “taaatgttttgatacaaattatgagc” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • The following oligodeoxynucleotide primers were designed against the putative PfPP5 sequence found on chromosome 13 (AL049185; Plasmodium falciparum chr13_002073): ATGTTACACAACCATGATGTAGAAGAAG;TAAATGTTTTGATACAAATTATGAGC.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast