Example sentences for: ta-

How can you use “ta-” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • Tha Doggfather offers 250 pages of evidence to the contrary" (Ta-Nehisi Coates, the Washington Post Book World ). (This site includes news, audio clips, and a discography for Snoop Dogg.)

  • 3 is one of the most active L1s in a cell-culture assay [ 37] and is a member of the human-specific Ta-1 subfamily of L1s which encompasses the vast majority of active, young L1 elements in the human genome [ 22].

  • For example, in the family derived from Clone-5 × TA-1-68, the phenotypic distribution is a mixture of at least two components, showing the existence of a segregating gene.

  • The T. acidophilum A-ATPase A subunit encoding gene was amplified from genomic DNA using primers Ta-4 (ATGGATCCTTCTCAACGAAGAGCAGTG) and Ta-5 (GAGGTGAACATATGGGAAAGATAATCAG).

  • Pok-Ta-Pok was the first course, and some still say the best.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast