Words similar to ta-

Example sentences for: ta-

How can you use “ta-” in a sentence? Here are some example sentences to help you improve your vocabulary:

Tha Doggfather offers 250 pages of evidence to the contrary" (Ta-Nehisi Coates, the Washington Post Book World ). (This site includes news, audio clips, and a discography for Snoop Dogg.)
3 is one of the most active L1s in a cell-culture assay [ 37] and is a member of the human-specific Ta-1 subfamily of L1s which encompasses the vast majority of active, young L1 elements in the human genome [ 22].
For example, in the family derived from Clone-5 × TA-1-68, the phenotypic distribution is a mixture of at least two components, showing the existence of a segregating gene.
The T. acidophilum A-ATPase A subunit encoding gene was amplified from genomic DNA using primers Ta-4 (ATGGATCCTTCTCAACGAAGAGCAGTG) and Ta-5 (GAGGTGAACATATGGGAAAGATAATCAG).
Pok-Ta-Pok was the first course, and some still say the best.