Words similar to ta-

Example sentences for: ta-

How can you use “ta-” in a sentence? Here are some example sentences to help you improve your vocabulary:

The T. acidophilum A-ATPase A subunit encoding gene was amplified from genomic DNA using primers Ta-4 (ATGGATCCTTCTCAACGAAGAGCAGTG) and Ta-5 (GAGGTGAACATATGGGAAAGATAATCAG).
Tha Doggfather offers 250 pages of evidence to the contrary" (Ta-Nehisi Coates, the Washington Post Book World ). (This site includes news, audio clips, and a discography for Snoop Dogg.)
For example, in the family derived from Clone-5 × TA-1-68, the phenotypic distribution is a mixture of at least two components, showing the existence of a segregating gene.
Pok-Ta-Pok was the first course, and some still say the best.
With probability of almost one, parents TA-1-91, TA-2-68, TA-4-91, XTA-3-6 have genotype A 1 A 1 , parents TA-1-68, TA-1-75, CLONE-5, TA-5-61 have genotype A 1 A 2 and the rest parents have genotype A 2 A 2 . The estimates of the genotypic values of A 1 A 1 , A 1 A 2 and A 2 A 2 are 11 = 56.