Example sentences for: ta-

How can you use “ta-” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • The T. acidophilum A-ATPase A subunit encoding gene was amplified from genomic DNA using primers Ta-4 (ATGGATCCTTCTCAACGAAGAGCAGTG) and Ta-5 (GAGGTGAACATATGGGAAAGATAATCAG).

  • 3 is one of the most active L1s in a cell-culture assay [ 37] and is a member of the human-specific Ta-1 subfamily of L1s which encompasses the vast majority of active, young L1 elements in the human genome [ 22].

  • With probability of almost one, parents TA-1-91, TA-2-68, TA-4-91, XTA-3-6 have genotype A 1 A 1 , parents TA-1-68, TA-1-75, CLONE-5, TA-5-61 have genotype A 1 A 2 and the rest parents have genotype A 2 A 2 . The estimates of the genotypic values of A 1 A 1 , A 1 A 2 and A 2 A 2 are 11 = 56.

  • For example, in the family derived from Clone-5 × TA-1-68, the phenotypic distribution is a mixture of at least two components, showing the existence of a segregating gene.

  • Pok-Ta-Pok was the first course, and some still say the best.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast