Example sentences for: subjects

How can you use “subjects” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • Subjects were asked how often, on average, they had consumed the specified amount of each item.

  • Although the subjects taught differed little from those offered at other camps, the course placed extraordinary physical and mental demands on its participants, who received the best food and other amenities to enhance their strength and morale.

  • Anyway, from there, the subjects pretty much suggest themselves, and it's just a matter of coming up with the right hook and good lines.

  • The insertion/deletion genotype of subjects was performed using purified genomic DNA (prepared as above) and the polymerase chain reaction using the forward primer 5'CTGGAGACCACTCCCATCCTTTCT3' and the reverse primer 5'GATGTGGCCATCACATTCGTCAGAT3' as per Rigat et al [ 13].

  • If men must naturally write only of men, and women only of women, then feminism and femininity become the only natural subjects for women writers and reporters.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast