Words similar to pvt

Example sentences for: pvt

How can you use “pvt” in a sentence? Here are some example sentences to help you improve your vocabulary:

After an Edenic prelude, in which a boyishly idealistic absent without leave soldier, Pvt.
The resulting vector was digested with EcoRI, dephosphorylated with calf intestinal phosphatase (CIP, NEB), and a PCR product generated from pVT27 (Abedi et.
Lastly an ~1 kb "stuffer" fragment containing most of the STE4 gene was inserted into the XhoI and BamHI sites to aid in purification of doubly digested pVT560.
The CAS peptide was transferred to pLexA as follows: Two complementary oligos which encoded the 11 amino acid CAS peptide (oVT2899: AATTCTGGAGCTTCTGGATCCAAGAATGGAATCAAAGTTAAG, and oVT2900: GGCCGCTTAACTTTGATTCCATTCTTGGATCCAGAAGCTCCAG) were annealed in PCR buffer and cloned using standard methods into pVT725 via EcoRI and NotI restriction sites.
It's no wonder that, later, the men go through piles of dog tags taken off dead Americans with little more than numb irritation and that when they finally stumble on Pvt.