Words similar to pvt
Example sentences for: pvt
How can you use “pvt” in a sentence? Here are some example sentences to help you improve your vocabulary:
It's no wonder that, later, the men go through piles of dog tags taken off dead Americans with little more than numb irritation and that when they finally stumble on Pvt.
The CAS peptide was transferred to pLexA as follows: Two complementary oligos which encoded the 11 amino acid CAS peptide (oVT2899: AATTCTGGAGCTTCTGGATCCAAGAATGGAATCAAAGTTAAG, and oVT2900: GGCCGCTTAACTTTGATTCCATTCTTGGATCCAGAAGCTCCAG) were annealed in PCR buffer and cloned using standard methods into pVT725 via EcoRI and NotI restriction sites.
The first of the Union dead buried there was Pvt.
I find Damon's proletarian integrity deeply suspect but must admit that he holds the camera like a star and that finding Pvt.
The resulting vector was digested with EcoRI, dephosphorylated with calf intestinal phosphatase (CIP, NEB), and a PCR product generated from pVT27 (Abedi et.
Loading...