Words similar to pvt

Example sentences for: pvt

How can you use “pvt” in a sentence? Here are some example sentences to help you improve your vocabulary:

After an Edenic prelude, in which a boyishly idealistic absent without leave soldier, Pvt.
"Kill Pvt.
pVT560 was constructed by first filling the BamHI and XhoI sites in pEG202 (Gyuris et.
The CAS peptide was transferred to pLexA as follows: Two complementary oligos which encoded the 11 amino acid CAS peptide (oVT2899: AATTCTGGAGCTTCTGGATCCAAGAATGGAATCAAAGTTAAG, and oVT2900: GGCCGCTTAACTTTGATTCCATTCTTGGATCCAGAAGCTCCAG) were annealed in PCR buffer and cloned using standard methods into pVT725 via EcoRI and NotI restriction sites.
The resulting vector was digested with EcoRI, dephosphorylated with calf intestinal phosphatase (CIP, NEB), and a PCR product generated from pVT27 (Abedi et.