Words similar to prohb-egf
Example sentences for: prohb-egf
How can you use “prohb-egf” in a sentence? Here are some example sentences to help you improve your vocabulary:
Previously we have examined the protein-protein interactions of proHB-EGF with the cell-surface CD9 antigen [ 9 ] . The CD9 antigen is found on a wide variety of tissue and cell types and has been reported to be involved in such cellular processes as B-cell development, cell metastasis, platelet activation and adhesion, and cell motility [ 14 15 ] . CD9 antigen is a member of the tetraspanin superfamily and consists of two extracellular domains sandwiched between four highly-conserved hydrophobic transmembrane domains [ 14 15 ] . The second extracellular domain (75-130 amino acids) is larger than the first extracellular domain (20-27 amino acids).
To test whether the fibulin-1C interaction with proHB-EGF maps to the heparin-binding region, a construct, pGBT9/prodelHB-EGF, containing amino acid residues Asp 106-His 159(the entire EGF like region of proHB-EGF and 18 out of 32 residues of the heparin-binding region) [ 2 ] was used in the yeast two-hybrid system (see materials and methods).
The extracellular domain (amino acid residues Glu 24-His 159) of monkey proHB-EGF (GenBank accession number Q09118) [ 2 ] was amplified by PCR using primers MkHB-EGF ex (5') TCGGCACTGGTGGAATTCGAGAGCCTGGAG and MKHB-EGF ex (3') CACAGCCAGGATGGATCCATGGTCATAGGT.
3and materials and methods) was tested using the yeast two-hybrid system and found to interact with the extracellular domain of proHB-EGF (Table 1).
The interaction of fibulin-1C may map to the heparin-binding region of the extracellular domain of proHB-EGF or it may map to the EGF-like module of proHB-EGF or it may map to both of these regions within proHB-EGF.
Loading...