Words similar to prohb-egf

Example sentences for: prohb-egf

How can you use “prohb-egf” in a sentence? Here are some example sentences to help you improve your vocabulary:

Some of these cDNA library clones were transformed into the other yeast host strain, Y187, and tested for β-galactosidase activity as a further check that these clones did indeed contain potential protein-interacting partners for the extracellular domain of proHB-EGF.
The extracellular domain of proHB-EGF interacts with monkey fibulin 1C
Previously we have examined the protein-protein interactions of proHB-EGF with the cell-surface CD9 antigen [ 9 ] . The CD9 antigen is found on a wide variety of tissue and cell types and has been reported to be involved in such cellular processes as B-cell development, cell metastasis, platelet activation and adhesion, and cell motility [ 14 15 ] . CD9 antigen is a member of the tetraspanin superfamily and consists of two extracellular domains sandwiched between four highly-conserved hydrophobic transmembrane domains [ 14 15 ] . The second extracellular domain (75-130 amino acids) is larger than the first extracellular domain (20-27 amino acids).
The extracellular domain (amino acid residues Glu 24-His 159) of monkey proHB-EGF (GenBank accession number Q09118) [ 2 ] was amplified by PCR using primers MkHB-EGF ex (5') TCGGCACTGGTGGAATTCGAGAGCCTGGAG and MKHB-EGF ex (3') CACAGCCAGGATGGATCCATGGTCATAGGT.
Detection of the physical interactions of proHB-EGF with CD9 antigens