Words similar to primers

Example sentences for: primers

How can you use “primers” in a sentence? Here are some example sentences to help you improve your vocabulary:

Primers to amplify regions without an Rsa I site were designed for two stress-induced genes, the pathogen-inducible PR1 gene (PR1-F: ATGAATTTTACTGGCTATTC; PR1-R: AACCCACATGTTCACGGCGGA), the O 3 -inducible amino-cyclopropane-carboxylate (ACC) synthase gene, ACS6 (ACS6-F: CATAAGTGTTGCGGAAGTAA; ACS6-R: GGCAATGGAACGAACC) and the jasmonate-inducible defensin gene, PDF1.
PCR assays were performed with Roche Taq DNA polymerase (Indianapolis, IN) in 50 μL reactions for 30 cycles under standard conditions and T a Of 63°C, using 2.5 mM dNTPs and 0.5 μM primers.
Briefly, first strand cDNA was made using 0.25 μg of RNA, Superscript II H-reverse transcriptase, antisense gene-specific primers and conditions of 30 min at 50°C.
For sequence analysis, the prospects are more promising: given very limited information about a species (the GC content), it may be possible to estimate the codon usage and therefore minimize the degeneracy of PCR primers, even if no closely related species have been characterized.
Forward and reverse PCR primers (5'-gaagaaaaactctcttttc-3' and 5'-atttgctgggttgaaaaatg-3' respectively) were used to amplify 300 bp region containing two ACS like elements.