Words similar to primers

Example sentences for: primers

How can you use “primers” in a sentence? Here are some example sentences to help you improve your vocabulary:

Diluting the cDNA template 100-fold prior to amplification with β-actin primers checked the quality of the cDNA.
The 8R96 intergenic region probe was generated using primers 8R96-225683FWD (CAAGTGGGCTCCATAATAGC) and 8R96-226069REV (TGGAGCTCTCGGTCTGTTAG).
Several primers were designed to amplify and sequence the 5'-upstream sequences of the ifkA and ifkB ORFs.
Primers were designed from the BAC clone (NCBI, NIH, USA, RP11-407) containing the MADS-IX sequence to obtain a 2 kb sized PCR product encompassing the MADS-IX region (Table 1).
Amounts of input DNA, primers and polymerase could be standardized, rapidly yielding accurate genotyping assays but without the highest accuracy under suboptimal conditions.